Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2125
Contig Information
Length 925 bp
Tissue Callus
Clones 17 Clones [Download: CSV  ,  FASTA ]
whcs10c13    whcs10c14    whcs5g04    whcs5i01    whcs6a10    whcs6a21    whcs8e02    whcs14a05    rwhcs10c13    rwhcs10c14    rwhcs5g04    rwhcs5i01    rwhcs6a10    rwhcs6a21    rwhcs8e02    rwhcs14a05    rwhcs2j19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit HNH endonuclease [Acidothermus cellulolyticus 11B] >gi|117649621|gb|ABK53723.1| HNH endonuclease [Acidothermus cellulolyticus 11B]
Score 93
Evalue 0.210989
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2125
TTTTTTTTTTAGCGTAGACCAAGTATCCATTTTTTATTATTATTTTTGAACACAAGAAGGGCCCCGAAGGACCCAGACTTATACTAGATAAGCATGCAAC
ATATTACAGAAAGGCCCAACAGAAAGAGAAAATTACAACCCAGGCCGGACATTTTGCAGATAGGACCCCAGACAACAAAAATGAAAAGCAATCGAGTCCT
CTTCGCCGTCTTCGATCCTGGCCCGATCCCACCACCACCGGGGACGAAACCACTTGGGGTGAAGGAATGGCTACAACACCGCCGGCAAACAACCGGAGGT
AGACCATGGAAATACCAGGACAAAGAACCAGATAAACTGCCTCCCATATGGCTCGGCGGCCAGGAGGAAATACAGGAGCCGGACGTCGTCGCCAGAACTC
CGAGTGGTCGCCTTTCGACCAGCAGATACAGCGGTGCAGTGGCAAGAAACTCCTGGTGCTCTCTGCACCAAGATCCCCAACCATTTGCTGCAGAACTTGG
GCTCCAAGGACACGCAGAGAGGATAGAGCAGCCAAATCCCCTTTCTTCCTCTTCTTCCAATCCACCTCCATGGCAGCTCGAGGAGAAGTAAGGAAGAAGG
AGCTTGAGCTCCAGATCTGAGAGACCCGCGAGCTTATTGAGAGGGATTTCGCCAGATCCAGCGCCTCCTCCCTTCCTCCACCATGGAGACGAAGAAGAAG
ACAAGAACGGCAACCACCGGCAGCTGCTCGCAAGCACCGGCGGTAGAAACCCCAACGGCATAGCGCCAAACCACAAGACGACCTGAACTAAACCAGTATA
TACAAGCATCTCCCGGGTGCCTCTCCCAAGCCATCGTCGATCGGCATCGCCGACGGACGAAGCTCGAGATCGGGCCGGGGTGCTTGGAGCGACTCTCAAA
GGGACGGGTGGAGAAGGAGAGACGG
page-top