Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2120
Contig Information
Length 1041 bp
Tissue Callus
Clones 16 Clones [Download: CSV  ,  FASTA ]
whcs12k24    whcs3e24    whcs3f15    whcs3o01    whcs6b13    whcs18b18    whcs19e09    whcs19e10    rwhcs12k24    rwhcs3e24    rwhcs3f15    rwhcs3f16    rwhcs3o01    rwhcs6b13    rwhcs6o11    rwhcs18b18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 4.75407e-117
Total Hit Count 494
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2120
TTTTTTTTTTAAACTAAATATTTAGTTTTCAACTCATTACCTCCATCCAGAAAGTAACACGAACAAAATAAGATAGCGGAACACTGGCTAGGAATGTCGA
CAGAAGTACTCAAGAAATCAGCCATCAAAACTGACTACAAAGTTCACGACACCCAGGTGGCACATATATCATCTTCTAGATATGAAGCAGCAAAATAGCA
ACTTCTATCCTCTACTCAGCAGCAGCAACCTCCTCTGCTCCAGGAATCACCTCATCTCCATCAGCAGGCCTGTCAAGCTTCACACCAACATCCTCCTTGT
AGTCACCGTGAACCTCCATGAGCTTCCCCAGGTCGAACTTGGGGGCCTTCAGGATCTTCACCTTGCGGACGTACACGTTCTGGAGGGGGAAGATGCCTGA
GGTGGCCTTCTCAATCTCCTTTCCAATCACCTCAGGGATGAACTTGTTCACAAGCTCCTTCAAGTCACAGCTTGCAGCTTGGTTGACCATGATCTCAACC
ATCTTGCGGCGGATCTGTCTGATCTGACTTGCTTGGGCATAGCAAGTGCGCTTCACCTGGTTTGGGCGTCTCTTGGTGAAGCCAATGGCGAACATGCGGA
GCATGTAGTTGTCAGTGGTCTTCACATCCACATGAGCCTCAATGAGTGTCTGCCACTTCCTCACAAGAGACCTGAGCTTGTCAGTGGTGAAGTCCATGCC
CCAGAAGTTTGTGAGGACATTCATCCCTTGCACATCCTCAGCACGGAGTCTGATCTTCCTGTAGGCCTGGTCCTCATCGTTCTGAAGATCAGCTAGAGAT
ACTTCGAACACCCTGTGCTTCAGACCCTCTGAGGCAATCTTGGTACCCTGCGTCCTGGACACGAGGGTCTTGCCGACGTTGCGGCTGGTGAACAGCAGCG
GCGCCTTGATGTCATACCACTGCTTCTTGGTGAACGGATCGACGGCCTTCTTTTTGCTACCCTTCCTCCCCTTGGAGATGCGCTTGTTCTTGCCGACCGC
CATGGTTGCCGCTGCGGGTGGAGTGGCGGCGCTGCGGCGTC
page-top