Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2113
Contig Information
Length 1635 bp
Tissue Callus
Clones 15 Clones [Download: CSV  ,  FASTA ]
whcs10j10    whcs11j12    whcs14n22    whcs15m09    whcs19m14    whcs20b13    whcs2f09    whcs2h23    rwhcs10j10    rwhcs11j12    rwhcs14n22    rwhcs15m09    rwhcs19m14    rwhcs20b13    rwhcs2f09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2262
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2113
CCGCCCGCCGCCGCCTCCCCTCCCTTCGTTCTTCTTCTTCGAGTTGGGTAGTTTACCTCTACCCACCAGCCATGGGTAAGGAGAAGACTCACATCAACAT
CGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACGACCACTGGCCACCTGATCTACAAGCTTGGAGGCATTGACAAGCGTGTCATCGAGAGGTTCGAG
AAGGAAGCCGCTGAGATGAACAAGAGGTCTTTCAAGTACGCGTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGAGAGGTATCACCATCGATATTGCTC
TCTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGA
CTGTGCTGTTCTCATCATCGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACACGTGAGCACGCCCTCCTTGCTTTCACTCTT
GGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGACGCCACCACTCCCAAGTACTCAAAGGCGCGTTATGAAGAAATTGTCAAGGAGGTCTCTTCCT
ACCTGAAGAAGGTCGGCTACAACCCTGACAAGGTTCCCTTCGTCCCCATCTCTGGGTTTGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTG
GTACAAGGGCCCAACCCTTCTTGAGGCGCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTCCAGGACGTTTACAAG
ATTGGTGGCATTGGAACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTCACCTTTGGTCCCACTGGTCTGACAACTGAGG
TCAAGTCCGTTGAGATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTTGGCTTCAATGTCAAGAATGTTGCCGTGAAGGATCTGAAGCG
TGGTTTTGTTGCATCCAACTCCAAGGATGACCCTGCCAAGGAGGCAGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATTGGCAAC
GGCTACGCCCCAGTGCTGGACTGCCACACCTCGCACATTGCTGTCAAGTTTGCTGAGCTGGTGACCAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGG
CCCTGCCCAAGTTCCTCAAGAATGGTGATGCTGGCATAGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTTGCTACTTACCCACCTCTTGG
TCGTTTTGCTGTCCGTGACATGAGGCAAACTGTGGCTGTTGGTGTCATCAAGGGTGTGGAGAAGAAGGACCCAACCGGCGCCAAGGTGACCAAGGCTGCC
ATCAAGAAGAAATGAGGCGTTTACCTGAATCCATCTATGTCTGCTTTTGAGATCTCTAGTAGTTTAGTGCAAGTTTTGCTACTGTTAGCGCCGTGTGATA
TGCGCCCTGTTGATGTGTCATTTGAGTACTGTCGTTAATTTTGGCTTTTGGCAAAACATGGAAGCTTCTGAGACTACTCATTTTTATCCTCTGCTTTGGA
ATGTTANGCTGCTACTTTTANTCTTAAAAAAAAAA
page-top