Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2118
Contig Information
Length 762 bp
Tissue Callus
Clones 16 Clones [Download: CSV  ,  FASTA ]
whcs10c11    whcs10d02    whcs10l19    whcs12g17    whcs15m16    whcs16f12    whcs16i17    whcs16j05    rwhcs10c11    rwhcs10d02    rwhcs11h13    rwhcs12g17    rwhcs15m16    rwhcs16f12    rwhcs16i17    rwhcs1e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor [Triticum aestivum]
Score 513
Evalue 2.94323e-50
Total Hit Count 304
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2118
CCCAAAGAGGAGGAAGAACACCAAGGACTCACTACCAGCGCCTCTCCGCGATCCAAATCCTCCCGGGAAAGATCTTGGTTGATCTCTTCCTCCTCGACCG
CCTCCCAGGTTCTTGGTGCAGCTTTTGCCAGTCTCAGCAGGAGATTTCATGTCTGATCTTGACGTTCAGATCCCAACTGCCTTTGACCCCTTTGCCGAGG
CGAATGCTGGGGACGCTGGTGCAGCTGCCGGATCAAAAGACTACGTTCATGTACGCATCCAGCAGCGTAATGGTCGCAAGAGCCTGACCACTGTCCAGGG
TCTGAAGAAGGAGTTCAGCTACAGCAAGATCCTCAAAGACCTCAAGAAAGAGTTTTGCTGCAATGGTACAGTTGTCCAGGACACAGAACTTGGACAGGTC
ATTCAACTCCAGGGTGATCAGAGGAAGAACGTCTCAAACTTCCTTGTCCAGGCCGGCATTGTGAAGAAGGAACACATCAAGATTCATGGTTTCTGAGCAA
CTGCCAGCTCCATATCAGAGTCTACATGCAAAGCAGCTATATATTGGTGGTGCAGTATATTTAGTTGTGTGCTAGCGCTAGCAGGCGTTACCAGCTTGCG
CGCTCTGAGTATACAGAAAATCTAGCATAGCCCACCTCTCTGCGTGTATGCTTGTTACCGTTGTGTTGAAACTTTGTAAGGAGCACCATCTTTAGATGGC
TTGTTACCCTCTCCCATCAAGGTTGAATAATATATGCTTTGTTAAGCGTGGTAAAAAAAAAA
page-top