Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec13a06
Contig Information
Length 668 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec13a06   
Homology (BLAST) Top Hit hypothetical protein OsI_36525 [Oryza sativa Indica Group] (no hit)
Score 571
Evalue 1.86721e-58
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whec13a06
ATGAACAGAGTTTTCGCAGAAACAAAGAACAATAGTCAATGTACATCTCACATGAAAATTGAGGTGGTAAAATAAAGGATCACACCGAAGGATCACACGG
GAAGGTCACTCCAGTTTTCTCTATGTGAGATACACCAGCCTAGAGCTCTAGTGGAAACTGGAAGACCACGAAAATCAGTTCCTAGACGAAAACAGCCCGT
GCTCAAGATGCATTTCCTCTAATAATGCCATCAACCCCGATCCTCATTCACGGAGGAACTGCCATGGCGTAGGGCCAGCCAATCTTTAGGTCATCCATCT
TTCCTAGCTTGTCTCCAAATAGTAGGAACTCATGGAGTACGAGCAGAGGGGCCGGCCAATCTTCACTGCTAGGTCATCCATCCTTCCTGGCTTGTCTCCC
CTGAACCCTCATGTTTGCTCCTTGTAACAACCAAGAGCGCAAAACATGGAAATCTTAGCCTGGACAGGGATTCGTCTGTTAACTGAGCTTGCGAAGTACA
ACAGCAGAACTGTACACATCTACTACTTCGTTACCATAGGCTGATCATTTATGACCTGATGTCAAAGTAAATCCAACCCAGTTCATCAATGTCCCTTCTT
TCATACATAGATCCAAACTGTTTTGAAGCAATAGCCTGGCTTTGATTTTCCTCCAAGCAACTTGAGAG
page-top