Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3f23
Contig Information
Length 704 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3f23   
Homology (BLAST) Top Hit hypothetical protein OsI_36525 [Oryza sativa Indica Group]
Score 571
Evalue 1.86721e-58
Total Hit Count 160
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3f23
CACAGGTTACAAAATTGCACCATACCGCATTAAGCAAGCAATTCAGGATGCGTCCACACGACAACGGCCATCCGTTTTAACGACATAATACATCTGAATC
ATATGACAATGACTTTCACGGTTCAGCTAACAACTACTACCTCCGATCCATAATAAGGGTCGCAGTTTTGAACTGACCCCAGTTCAAAACCGTGACACTT
ATTTTGGATCGGGGGGAGTAGCTAGTAACCAACTGATGCTGCGTCTGCTTAAAACTCAACCAGGAGGAAGAATTTGTCACGCAGAAACTACTTCTCTGGT
GGCGAGGTCAGCTGCCTTAGGTTGAACTTCGAAAGCTCTTTGTATCTCTCCACCACTCCAATCATGCATATAGTCTTGGCAATCTGAACAATAATAGTCC
TGTCAGGGTTGCTGAGGTCAACTTTGTGAGGCTGAGGTATAGATTTTGCTACTGCATTTATAATTTTCATTCTATCGATTCCTGTGTTTGACCTTGCTTC
GTATAACACAGCAAACTTATGTCCCGAAGGAGATTCTTTGGGGAAGTACTTTTCAACAAGTGGAGCAACAGCTCTTGTTATTTCCTCTTCTGAAGCATAA
CATACCACCTCAGCAGGCAACACCCTCAGAATAAACCTGGACATATGTTTACGAGTTGAAAGCAGCCGAANACATCATGCTTTGTACAATCTCAACTGGA
CCAG
page-top