Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec13a03
Contig Information
Length 217 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec13a03   
Homology (BLAST) Top Hit serine/threonine-protein kinase 16 [Zea mays]
Score 216
Evalue 2.64823e-16
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>whec13a03
AGCACAGCTGACACCCACCCCTCCGCCACCGCAGTCGCCGGTGACCAGGACGCGCGCCCGAATTCGCCGGTGGCGAGGAGAAGGGCGCCGAGTATGGGGT
GCTCCCTCTCGGGGCTCAACGCCCTCTACGACGCAGCGACTGGCGGCGGCGACGTGTGGATCAACGAGCGCCGCTTCCGCGTCCTCCGCCAGATCGGCGA
GGGCGGCTTCGCCTTCT
page-top