Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1i24
Contig Information
Length 721 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1i24   
Homology (BLAST) Top Hit RecName: Full=Phosphatidylinositol-4-phosphate 5-kinase 1; AltName: Full=1-phosphatidylinositol-4-phosphate kinase; AltName: Full=PIP5K; AltName: Full=PtdIns(4)P-5-kinase; AltName: Full=Diphosphoinositide kinase; Flags: Precursor
Score 822
Evalue 3.93468e-86
Total Hit Count 499
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1i24
TTGCCTATCGAGTATTTCCAGTGAAGAATATGTTCATTCTTTACAACAAAAACAACAACCAGAAAACAAAAATACCCATTACTGCTATGTACCGTTCATG
TCCTCTCTATTTTAGTCTTGCTCAGGGAAAACCCTCTCCAAGAAACTAACGAATCGTTTCGAATACAAGTTCGGATCAACAGATGATATCGAAAGGGGGT
CGAACTTGAGCGATTTGACCGCATGCTCTACCCTCTTGGACGTGTTGTACTCCTGCAGTATGTCTATGATGCCGAGGTAGAGCACAACGTCGTACTCCTC
GACCGCGTCCGTGCTTTCCAGCAATTTCCGAGCTCGGGCCGGCATGTTCACCCCTAGCTGCACACGGAACCTGCCGGTGTCTGGCAGAACAAGATCGACT
TCTTCGTAACCACCTTCTGATGCTCTAACCATGCTCCCTCTGATGTGGGAACCGCCTACGGTCGTACCTGGCTCGTGAGCAACTAGAAGAAATCCCTTTG
AGGAGTTCGCATCCTCACAATGCAGTGGCACGTTACAATCCATTGCAGACGTAATTCCACTGCTTTCGAGTGTATTCTGATGTGACGTGGCAGTCTTCAA
GTGATTGGGGGCTCTGAAATGGATTCCCAATAGCATGCTATAGTCAATAATCGATTGGGATTCCAGGAACATACTATCAAGAGCTATCTGCCTGAAAAGC
GCTTGCCTCCACGATTTATCA
page-top