Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10m09
Contig Information
Length 590 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10m09   
Homology (BLAST) Top Hit actin-depolymerizing factor 5 [Zea mays] >gi|195634937|gb|ACG36937.1| actin-depolymerizing factor 5 [Zea mays]
Score 660
Evalue 1.51717e-67
Total Hit Count 467
Registered year 2003
Contig Sequence     [ Download ]
>whec10m09
CGCAGCGCCAAGGAAGAACCCCTCCCTTCTTCCACCGATCCTTCCCTCCTTTCCTCGTCCTCACCGGCGACGACCCGCAGCCATGGCAATGGCTTACAAG
ATGGCGACGGAGGGGATGAACATCAAGGAGGAGTGCAAGCGGTGGTTCACGGAGATGAAGTGGAAGAAGGTGCACCGCTTCGTGGTCTACAAGATCGACG
AGCGGACGCGCGCCGTGCTGGTGGACAAGGTGGGCGGCCCCGGGGAGGGGTACGAGGAGCTCGTCGCCGCGCTGCCCGGCGACGACTGCCGCTACGCCGT
CTTCGACTTCGACTTCGTCTCCGTCGACAACTGCCAGAAGAGCAAGATCTTCTTCATCGCATGGTCGCCGGCGGCGTCGAGGATAAGAGCCAAGATTCTG
TACGCGACGTCGAAGCAAGGCCTGCGGCGGGTGCTGGAGGGGGTCCACTACNAGGTGCANGCCACCGAGCGCTCCGANATGGGCTTCNACGTCATCANAN
ANCGCGCGCAATGANCGAGCCGCCGCCCANANCGAGCTTTACTATGTTGGTGTGCCTGTCNCCNACNATCNCCNNTGTACTATANTCNAA
page-top