Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10m06
Contig Information
Length 694 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10m06   
Homology (BLAST) Top Hit unknown protein [Arabidopsis thaliana] >gi|5734713|gb|AAD49978.1|AC008075_11 Is a member of PF|01169 Uncharacterized (transmembrane domain) protein family. [Arabidopsis thaliana] >gi|26452502|dbj|BAC43336.1| putative transmembrane protein [Arabidopsis thaliana] >gi|90568024|gb|ABD94082.1| At1g68650 [Arabidopsis thaliana]
Score 171
Evalue 7.50974e-15
Total Hit Count 144
Registered year 2003
Contig Sequence     [ Download ]
>whec10m06
ATCGGCAGTTTTCTTGGATGAATCAGCCTACCTGCTAGTATGTTCAGCTCGCCGCACATGGTTTACACGCATAAAGAGGACCCTGCTGGCCGGCCTTTTG
TTTGTTTCTTTGTTTTGATTTGACTCCGGGGCTGCTTGCTGTTGCTGCGCTTCCCGATTTTGGTAGCCACACCAGCTGGGCTCTCCACTTGCGTTGGACT
GTTGCTAGTTTTGGGTCAGATGCATGCTGGCCAGTCCTTTCCCACCGAAAACTGTTTCACCACCTGACCAGGGTAAACCTTTAGAAGCATCGCTCCTATC
TGGAGTGATTTCTGTTTACAGAATGATTGATGGGCTTCACAAGGTCTGGAGTAGCAGGACAAAGATATTCCTTTCTAGTGATAAACTGCTAGTCATTCCC
CACTTCGACATAGATTTCCTTTTCTCTTTTACTCTGCTCTGCGCTCTGTTTCTGTTGCTGTGTTTTTCTTTTATATTTGGTGGGCTTGTGATGTTTTCCG
TTTACTTGTGCAAGATTCTGGCCATGCGCCATCCACGGAAGCTCGTCCTTGCTGGCTGTCTATCGGCATTAACAGTGATGACGGCTTTATCTGCTTCTCT
AGGCTGGGTTGCGCCAAACCTGATATCACGTAAAATGGACTCATCATATCACCACTCTGCTGNTCTTTGNGNTTGGCATCTGGCATTGNGGGAA
page-top