Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1j11
Contig Information
Length 814 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1j11   
Homology (BLAST) Top Hit pre-mRNA-splicing factor 19 [Zea mays]
Score 70
Evalue 0.000545947
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1j11
CAGTCAAAAGGAATATTTCAGCGGGTTTTCGCCACATACAAAAGTTGTGTAGCGTAGTACAGCAACTGACCAGATATGATTCCATCGTGGTTAACTACAT
ATGTAGCCATCGTGGTTAAGACGAAGTGACAACACCGTCGCTCACCAGTGACTCGGATGTGACGCCAACCTCGCTGACTGCCAAGTTCAACCACAGAAAG
CGTTTTGAATGTTTAACCTCTGTTGGAAGGGAACACAATTATAACCTCGGAAAAACCAAGGCCCCGGTCCAGGAAAAACCCTAGAAATCCATGTCGACAG
GATAGCGGAATCCTCGACGTCGCTTCTGCCTGCCTCGTGCAGTTCAAGTTCAACCATATGCCTGGTAATTCGACCTATACATAATATAAATCCAAAACCT
AGGGTACTGTCTACACGCACCCCCTATGACCCACCCCAGCTGCGGAAAGCCTTTCTGCATCCTACATATTTCGGCGCAAACATCATCATCAAACTACAAA
AACATGCGGCTCACCCAGCAGGTTTGCTCAGCTACTTGGACCGCCTGGCTGCTTCAGTTCGGGGACATGCATTCCTCTTTCAAGCATATCCTGGACAAGA
CGCGCAGGGCTAACCACCAAAGGCAAAATGGTTGTGGCGACAACATGTATCGTCGTCTACTCATTGCTCCGCTGATTCTCATTTTGCCACCTCCATCTGC
TCATCTCCAGGGAGCCCGAACACGCGCAGGTTGTGGGTCCATGGAACCTACGGCCACATACTTAGCATCTGCCCCCAAACTTCACCGATGTCACTTTCCC
TGTGCCCGGATAAA
page-top