Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1j13
Contig Information
Length 760 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1j13   
Homology (BLAST) Top Hit Os05g0533800 [Oryza sativa (japonica cultivar-group)] >gi|48843828|gb|AAT47087.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579695|dbj|BAF18058.1| Os05g0533800 [Oryza sativa (japonica cultivar-group)] >gi|125594999|gb|EAZ35058.1| hypothetical protein OsJ_018541 [Oryza sativa (japonica cultivar-group)]
Score 550
Evalue 1.5081e-54
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1j13
AATTCATTTCATCATTTCGTCTGGAAGAGCGTAATTTGCCCTGATTTCAGCAAGCAAGCAAGGCAAACATCACAGTCACAGATATCTCATCTGTCCAGGC
TTCAATCACTCAACTAAGCGTGCGACAAATTATTAGACCTCATCGACGAGTCGAATTCACCGAGCCGGGTGTACTTTTTTCACCAGCATCAAGAATAGTA
TTTCAGAAAACCAAAACTTCGCACCGCGCATCACGAGAAACTGATTGGCTAACAGAGTCTTCAGCTCTTAATCGACGCCGATCGCGTGGAGGTACTCATG
GAAGGAAGGCGCTCAGACGCTGTAGCCCGTGAAGGTGAAACCCCGGCCGGCGATCTCGCCGATGCAGAACCACCCGTAGAGCTCGAGGCCGAACAGAGCG
ATGATGCCCGCGTGCTCCACGTTCAGATCTTTCCTGTTTCTCCACAGCTGCTTCACTTGGTCCGCCTCCTTCCAGAATGCCTCGTAGCGGACGGGGAGGC
TGGCGATGCGGGTGTAGAAGAGCTGCTTGGAGAGCTCCTGGCACTTCTCGACGGTGGGGGGCTGCACGACGAACTGCTTGTTCTTCTCGATGAGGGTCTT
GTGGTAGGCGCACCCGTTCCTGGTCACGAACCGCGTCGCCTCGCAGGCCTTGGCCTGCAGCTGCGCCAGCTTGGACCCCANCGCCGCCATGGACGGATCT
GCTGCGACGCGACGGCTCCTTGGGGGATCNGANGANGANGANGCGGNNCGGNTGTGGNNT
page-top