Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3f24
Contig Information
Length 656 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3f24   
Homology (BLAST) Top Hit hypothetical protein OsI_33779 [Oryza sativa Indica Group]
Score 272
Evalue 2.18915e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3f24
CACCACAGGGTCTGTTGGATAATAAATAGGAATGTTCCTATTATGGGCTATTTTAATAAGTTGTAACACTTCCTTGGTTGCATTTTTTTCTAGCAAACAG
GAGGACACTGGAATTCCAAGGCCATTCATTATTTGAAATGATAACTTTCCAACAAGAAACAACCCATCGCGTTGAAGGCTAACAGATGCGGTGCAGGTGC
CTTTCTCAAGAAGTTACTGCCTCCAATTATTGCTATGTATGGCGCCTTGTGGTGTCATTGATCTTTAGCGATTGCATAAGCTCCTCCTCAAAATGGAAAC
CAGCAAGAGATGCATAGCAGAAACGAGTGATGCCAACCGTTGATGCGTGAATCTTATGAGACAATGAGAAAGAATCATTGACAAAGATTGATGATGTTAA
ACAAGGGACACCATCCACCGGGATGACCTTTACTTGAAGAAGCGCTGACATATAGTCTGACTATCAGCATTTATGACAGATTATTTTCAGTTATCAAGAA
CGAACAAAAGAAGCTGTTCTGGATAAGTTAGCTGCAAAAGATTTGATTGACTTGAACACTGGATTAACAGACTGGGGGACTGGTAACTAGAAGAACTTTC
CCTCCTGCTTTGTACAGGTATTTGATAGTTGACAGTGTCCTTTTCAGTGAGCAACT
page-top