Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3h16
Contig Information
Length 309 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3h16   
Homology (BLAST) Top Hit Os06g0127300 [Oryza sativa (japonica cultivar-group)] >gi|113594703|dbj|BAF18577.1| Os06g0127300 [Oryza sativa (japonica cultivar-group)]
Score 166
Evalue 1.66907e-10
Total Hit Count 14
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3h16
ATATCATCATGGTCCAGATTACACTCTACTACAACCAGTGGCAGTGACACACTCATCTCTAATCTCTTCTCGTCTCATCTCACTTCGCCGGCTTGCGTCG
CAGTGCAAGCAGAGAGACGGGCTACAGTAACAAACTCTGACGCCGGTGTAGAGCCGATGCTAGCACACGAGCGAGGCGCGGAGGGAGAGGGTGGTGGACA
GGTGCGTGCACNACGCCCACCGGATCACCGACTCGGCCACCGCCATGTCCAGGTCGTGCTGGTGCCCCCGCTCGTCGCCGGCGCCAATGGTGTGGTTCCG
CCTGATGCG
page-top