Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3j24
Contig Information
Length 248 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3j24   
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195626476|gb|ACG35068.1| hypothetical protein [Zea mays]
Score 119
Evalue 4.70728e-05
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3j24
GCACACGCTACTTCTTCTTCTTCTTCTTCAGATTCAGATNACACGCTGACACCGACATACAGTACAGGGGGGAGAAGACGGCGCTCATCCCTCTCCTGAA
NCCCCGATCACTGGCTGAGCAGCAGCATCGCCTCCGGCTGCCGCCGCTGCCCGAAGCCGTGGAACGGGTGGCGGNGGTGCANCTCCTCCACCGCCTCCTC
GCACATGCTCNNCGGGTCTGGTTGGGACACNANGTTCTCCTTGTNCTC
page-top