Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1k02
Contig Information
Length 745 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1k02   
Homology (BLAST) Top Hit transposable element tc3 transposase, putative [Talaromyces stipitatus ATCC 10500]
Score 80
Evalue 4.5679
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1k02
TCCAAATTTAGTACAAGCCCAAGCTAGGGTACAAACTACGGTGAAGAATGATACATGTCATCAGAGGCATTCCAAGATCACATACATTATTTATCTACGC
CTTCGGAACTCAGTACACACCTAGTCATATCCCACAAGACACGCAGGACTGTGGAAGATACAACAACTACCATTCTACTACTACCATGAACCACCTCAGG
CATCTCCGTAGTAATCCTCGTAGAGGTTACCTTCATGACCCGGAAGCTGGACGTGGTGATCTGGAAACTCTCTATCACATGGAGCCTGTGGTCCAAATGG
ACACGGGTATGGGCACGGTCCCACAACTGGTGGTAGACGAGGACCACGTGGAAGGGTGATGCCTCCGACATCGGGCCAATCCATGCAGTCTGGCAGTGGA
GATCATACTGGATACAGTGTGACATATCAAGATATCCGGTCTAGACGATATGTGCTAGCTATGTCAGAGTAGTCCAGTGGCATGCTCGGGCAGCATAAAG
TTCCATCTGGAGGGCACGAACCTCCCGATCCCGGTCCTCCATTAACTGTGTAGCAGTCTGAAGTCTCGACTCCTCATGAGAGGCATTANTGTAGAGACAG
TAAGATAGCCCTCCTCGGTAGGGAGTGATGCTGGCATGTAACCGAACTCGGTGTTCTATAGCAATCCGTGCCTANCTTGGATTATGGTCATCATCNAATA
NGCAGTATCCTGAACANACATCTGATANTANCTCCNAGCCCATAC
page-top