Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3k07
Contig Information
Length 753 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3k07   
Homology (BLAST) Top Hit unknown [Zea mays] (no hit)
Score 880
Evalue 6.41444e-93
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3k07
CTTACATCAACCACGGAGTAGTTAATCCATCAGAAGCATCATCTCACGGCACTGACCATACATCGTTAGCAACCAAGAGCTAAACAAACACCACACAAAA
TAGAAGGCCAATGCTGATCATAGTACCAACAGCGGTTGGTCTTTCACAAGCACCACATTAGAGTTTTCTTGGGTCGGTGTAACGGAACATCGCATCGCAA
GCAATACGGCACGACAAAAGGGACGATAGACCTAGGAAGAAGCTTCACCATCTAACACACGTCGAGACGTCCATTCGCTAGACCATCAATGCGAGAGCAC
ATCTAACCAACACATCGTGGTCCTAGCTGACACACCAAAATAATGATCCACCTAGGGCCGTTTGGACTACAGCTTGGCCCTTTTAGTCGCTGACGTCTCG
TCTTCATCCGCCGCCAGGCTTTCAGTTGATTTGCTCAATGTAGCAGCAAGCTCACCACCGAGACCAGCAGAGCGTCATCCGGTTTTTCGAGCCCCTAAGC
ACGGCCATCAGAAAACAAGGGTTTACACAACACAGACTTAGGTAGACCACTTGCTGGCACTCTCTTTATACCGACACTGCAGGTCACAGACCCAACAAAT
TCACATCACATATCTAGAATCGTTTGTTTACGCCATCTTGGATCATTTTTGTTGGAACAACTCATACCCTTTTTTGACTGCTTGCTGGCACTCTCTTTAT
ACCGACACCTTTTTTGACTGAGGTCGGGGAAGAATTACTCTTCTTCCTTCGGG
page-top