Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3p15
Contig Information
Length 722 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3p15   
Homology (BLAST) Top Hit hypothetical protein LOC100193200 [Zea mays] >gi|194692650|gb|ACF80409.1| unknown [Zea mays] >gi|195628590|gb|ACG36125.1| zinc finger C-x8-C-x5-C-x3-H type family protein [Zea mays]
Score 351
Evalue 1.62361e-31
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3p15
TTCCTTCTCCAATGTACGTATTATCTCTACCTGTGAATCTTTCGGATGCTGTTTTTCAACTTAGGCTCCTTCCTTCCCGACTCTGCTCAAAAATAAAAGA
AACGAAACATGTACTTCAGACTTTCAGATATCCAGAAAACCAGAACACTACCATCCATACAGCTCTCCCAGCGGCGAGTTCACTGCAATCAGCATACAAC
AGACACAATACAAGTTGCGGCAGCATAATGTTTTAGTCTTACAACACGCAGACTCTTCCAGCACTAGGTTTTTGCAATGCCAACTAGAACTAAACTGGGT
AAAGGAGACAGACACGGCGCTCCTCTTCCTAGTCAGTTTCGTCTATCCAATCACCATAGATCCTGCTGATCTTGTCGGGGCCTTTCCATTTCTGGATTGG
CCTCTGTAGCTGCCCGGACCTTTGGCTAGCCAAGGCGGAACGCTGTGACTGGCTGCCTAAATGGTACACGTCTGCATGAGGGGGCACCGCAGTGGATGCA
GCAGCAGTCTCCACAGGAAGTTTCGAAGATGCCGTAGCCTGCTTCGAATCCGGAGTTGATGCAATGTCCCTCCCGTCAATGTCGACAAGTCCCCCACCAT
ACTTGTGGAGTTCTGCAATTACGACCAAAATATATGTCAGTAATGTAAAACTAGATTAGGTACATTATGTACATTAAGGCCCTGTTTGGTAGCAAAGTAC
TCCCTCCGTCCCATAATGTAAG
page-top