Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1k13
Contig Information
Length 807 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1k13   
Homology (BLAST) Top Hit hypothetical protein OsI_26926 [Oryza sativa Indica Group]
Score 782
Evalue 4.27987e-85
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1k13
TGGGCACAAGGGTCTGATTCGTCCTTTCAGTAAATTACACAATGGTACAGGAACACTACATGGGATACACCAACAATGGGTGGTAAATAAAAACTTCTAG
CAGGAACACCACAAACCAGATCTAACTTATTGCTGGCAACAAATCAAATTGTCTACTGATAAGTCTGATCTATATTAAGGGTTTGTAATCACAGATATGT
AGTCACACTTGAGCAAAACCTTGTATGAAATCATTCCATTTATCACCTTTGTGGTCCTTTATACTGTTCTATGTAGCCTTGGCATATGGGGCAAAAATGG
CTTTGACATCTTCAAACACCTCAGGAATTGGTTTTGCAGCATCGATCTTCTTAACCTTGTCCTTCGCGTCATAGTACTCAATCACAGGCAAACTGGATTC
AACAAAAACTTTGAATCTCTTCCTGATAGTCTCGATGTTGTCATCAACTCTACCCTCATTGCGTCCCAAAAGACGTCTTTCCATCTCTTCCTCAGAACAA
TTGAAGAATAGCACAAATGCAGGCGAAATTTTTGTAACATTCTCGAACGCAGCACGATTCTCTTCATTCCTTGGAAACCCGTCAATGAGGAACTTATCAT
TCTCATTCTTTATCATGGCTTGCTGCAAGAGCTTTATAGTCACCTCCGACGGAACAATCTTTCCCTCCTTTATCATGTTCTCAATCATAGTTCCATTCTC
AGAACCAGATTTAATCTCCGCGCGCAAAAGATCTCCAGCACTAAGATGGGTGAATCCAAAGTGTTCAACAATGTTGGAACACTGTGTGCCCTTTCCACTT
NCCAGGA
page-top