Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12p06
Contig Information
Length 274 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12p06   
Homology (BLAST) Top Hit fatty acyl coA reductase [Triticum aestivum] >gi|22003088|emb|CAD30695.1| fatty acyl coA reductase [Triticum aestivum]
Score 465
Evalue 3.5843e-45
Total Hit Count 101
Registered year 2003
Contig Sequence     [ Download ]
>whec12p06
CGTCTCCACGGCCTACGTCGCCGGCGAGAAGCAGGGGCTGGTCCCGGAGAGGCCGTTCAAGGACGGAGAGACGCTGCGCGACGACGGCACCCAGCTCGAC
ATCGACGCCGAGCTGAGGCTCGCCAGGGACCTCCGGAAGCAGATGGAGGCCGACGACGATGTCGACCCCAAGGCCCAGAGGAAGGCCATGAAGGACCTCG
GCCTCACCAGGGCCCGGCACTTTGGGTGGCCCAACACGTACGTCTTCACCAAGTCCATGGGGGAGATGATGCTG
page-top