Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2095
Contig Information
Length 578 bp
Tissue Callus
Clones 13 Clones [Download: CSV  ,  FASTA ]
whcs10a10    whcs10a21    whcs11p18    whcs12j09    whcs12p18    whcs7j20    whcs1e10    rwhcs10a10    rwhcs10a21    rwhcs11p18    rwhcs12j09    rwhcs7j20    rwhcs1e10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195618726|gb|ACG31193.1| hypothetical protein [Zea mays]
Score 379
Evalue 5.58796e-35
Total Hit Count 86
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2095
GTCTATTAAACGCAGCCGCCTCCTGCTTCTCGCCTTCCCCACCAAATTTCCGCCGAAGCAGAAAAAGCATCGTCTCGTCTCGTCTCGTCGAGGAATCAAC
AGCCATGGGCGGCGGCAACGCGCAGAAGTCCAAGATGGCGAGGGAGAGGAACCTCGAGAAGCTGAAGGGCGGCAAGGGGAGCCAGCTCGAGGCCAACAAG
AAGGCCATGAACATCCAGTGCAAGATATGCATGCAGACTTTCATCTGCACCACCTCTGAAGCAAAGTGCAAGGAGCATGCCGAGGCAAAGCATCCGAAGA
GCGAGCTCGTCCAGTGCTTCCCTCACCTCAAGCAGTGATATCTGCCCAATCAGACAGAGAGAGAGATAAAAGAGAGAGAGAGAGAGAAGCTGTCATAATC
CACCTACTATTATCATGTTCCGCAATGACTGATTGTTGACCTAAGCTTGGGGTCTGAACTCGGTGTGCTGCTGTCCCGGCTGCTTTGGTTGTGTGCCCAT
CTACTATGTAATCGTCCTCTATCAGCCTGTTGTGCTACATTATCTTAATCCTCTGTGGATTTGCTCCTAAAAAAAAAA
page-top