Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1k23
Contig Information
Length 865 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1k23   
Homology (BLAST) Top Hit hypothetical protein [Oryza brachyantha]
Score 340
Evalue 4.26525e-30
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1k23
ATTGTTTGGTTACAATATGTTGCAAAACATAGAACTGAATGACAGGACGTTGCTATGGTGATATTCCATCCGTAACACAAACAGTTTTCCATGGGAGAAA
TGAATGAAATAGATCCAGAGTACTCACAAGTCAAATGACACTGATCAAATTAGCTTGGGGGCAGAAAGGAGTTCTCTTGCTTGTGTCTTTGTCCCTTCAC
ATAATGCTGAGCAAATGAAGATTCCATCAACCATTCTAGTGCAGATGCATGGCAGCATTGAGGGTGATAACTTCCCCAATTCATAGTGTCCGCAAGTTTA
GGATAAGACCTCTCACTCAAATTTTCACCTCAGAATATAACACTCTCTTATCGATCAAGATCACTACACCATGGTGTAGATGCTAGCATGATAAATCAAT
CTTCCAATATGGTTCCCATGCCAGATTCAGAACTCAGGCTTCACTATATGACATTCAGTGTCGTTGTATGATTCTGTTCCTCAGTCGATGTAGAGTGATT
CAACTCCCGAGTCCTCCCCACTATCGGCACCATCGTCCTCATCGTCAGCACCAACTTTCCTCTTTCTGCCACCTGCATCCCCAAGAAACTTCTCCCTCAA
TTCTGCTCCACCACGACGACCACCACCAAGCTCATCCCATCCACGACCCATGCTGGTGAACATACGATCCAAATTCGCCTTCTCTCGGCTCATCAAGAGC
AGCTCCTCCAGCTTCCGCCTTGCGTCATGTATCTCATTGGAATCTAAAAGCTCCCCTTTATAGTAGGCCTCCCGGAGGAACACAGTGTGCAGCTTCCCCT
GGTTTCCTCTTGTTGATATGTAAAATATCCCCTGGTACTTAAGCAAGAACTCTTTTAATCTTCTT
page-top