Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12p05
Contig Information
Length 559 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12p05   
Homology (BLAST) Top Hit PREDICTED: similar to mKIAA1935 protein [Gallus gallus]
Score 86
Evalue 0.471042
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>whec12p05
AGGAAGATGAGAGGGAGAGAAAGGGGAGAGGAGAGGAGAGGGAGGCCCGGCAGCGGACGGGAGAGGGTGACCGGCGAGGCGTCGGCCTGCGCCCCTCCTC
GCGCACGAACCCTAGCTGAGAGACAAAATGAGGGGGAGAGAGAGAAGGAAGGAGAGGAGGGAGAAAGAGAGAGGAAAGAGGAAAGGGAGGTGCGGCGGCT
GACAGGAGAGAGGGTCATCGGCCGGCGCCGGAGAGGACGGGCCCGACCTGGACGCGACCTGGAGGTTGGCGGTGGCTCGATCCACTCCTGGGTCGGGAGC
TGCGACGAGGCTGGGGCTCGGGCGCGTTGTACGGGAGGATGTACTCCGCCTCTTCCTCATGGTGCGGCGGACGGCGACTCTCCCTCTTCTCTGTCGTCGG
CGGCCAGCTCATCCCACTGCCTCGTGCTCGCCGCTGACCACGGATCCGCCATGGACGGAGGGTATCAAGAGGGGAAGAGGGGAAGGACGTCTTCNCCTTC
NCAAGCAGCACTGGCGGACGAGCACACNCNCATGTCCTCTTCCTGATGGAAGGCAACTC
page-top