Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1l04
Contig Information
Length 604 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1l04   
Homology (BLAST) Top Hit vesicle-associated membrane protein 712 [Zea mays]
Score 564
Evalue 2.17617e-56
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1l04
AGGCGTCACAATTACAGAATAAATAGCAGGCTCAGGTCCCTCCCCTTCCTCTCTACACACAAAAAATAATTTTGCAATGCGACTGGTTGCACTGGTGCTG
CAACGGTCGCTCTCCTGGGCTGGGAGACAGGCAAGCCATGGACACAAGCACACCACGAGGCGAATTTATATGCCCCTGGCCCCCCTCACCTGATGCAAGT
CGGCAAGGTGAAGCCGTGGCACACGAAGAAGAGGGCGATGTATACTATTACAAGCAGGAGGAGTATCAACGCGGCCGTGAGTTTGACATTTCTCCACCAA
GTTGTGCTTCTGTAGCGGCGAGCTTGTCTTTTGAATCGAACCGTATTTCCTTGCATAGTTGTAGTCTTGTCCACCAATAGGTCTAAACGGTCACCTCTTT
CAAGGACTTTATCAATATTATCAATCATAACACTCCTAACCTGACTGATTTCGCCCCTCATTCGGTTGATTTGATCTGCACTAGGGTCATTTGAATAGTA
GTCCATTTGCTGACTGAGAACCCTTGAGAATTCGTCGTTCATTGCATAAGCAAGAGCTGTCAGTGCAGCACGGCCATATGTCTTAACAAACTTTCCATGG
ATAT
page-top