Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1l09
Contig Information
Length 761 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1l09   
Homology (BLAST) Top Hit cold acclimation protein WCOR518 [Triticum aestivum] (no hit)
Score 440
Evalue 8.12493e-42
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1l09
CATTCGCCAGTATTACATCACACTTACAAAGTTGTTATGTGGTGACATGCTAATCCTCCTCAAAACCTAAGCCATTGTTTGCGAGAATGGCCGGCGGCAG
TCAGAGTAAACCCATGAGGCCAATGCCATGGCCACCGCCCACCATGCCCGGAGCTCCTCGTTGGACCGAACGCGGTACCTCTCTGTGACGTCTGGTGCCA
CCTCATGAGACCCATCAGGCGCATGATCTATCCGTTTGATGGTGCCCATGTTGTTCATCTAAGCTCAAACTTGTGATAGGTAGTTGTGTACTACTCCACT
GTANAAATCTCAAGATACTGCAGAATGGTAGCATGGATACGATCACCCTCAAGTGCAGCCGTAAAAACTCATTATCGTTGTCGTCAGCAAACGCAAACAT
GGATCCACCAGTCATTACTATTGTCATTCAGCTTCCGCAATATCAGAAACCACAAAGAGAACTTAATGATGTAGATGAAGATAAAGCGGACGCATTAGGT
TCAGTGTCAAGTGGTTGTTGTACCTCAGTGGTCATTGCCGCCTCCTCAGCTATGATCTAATTGCAGCTCGTCGAGAGGGTGTCGGAGATGTTGTGGGTTA
NAATTCANAGAGATTGGAGTGTTTGATTCACTGATACTATTGGAGAATGGAGTTCCAAAACCTTCATTTGTGGTGTGTGCAAGACAGCTANCCTACAATT
TACAAGGAGCATAATAATTATTTTTAACCAANCACTATAACTAATGAACAANCAACTGTTA
page-top