Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12o23
Contig Information
Length 737 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12o23   
Homology (BLAST) Top Hit cold acclimation protein WCOR518 [Triticum aestivum]
Score 440
Evalue 8.12493e-42
Total Hit Count 301
Registered year 2003
Contig Sequence     [ Download ]
>whec12o23
ANCAGTGCGGCAGACAGTGCCTAGCGATTTCCAATGCCCTATGACGCCGCCATCGCCTGTCACCCCACCACCGACCCCTGTTACTCCTTCGCCTACACCA
AAAACGCCGCCATCCCCTGTCACCCCACCACCGACCCCTGTTACTCCTTCTCCTACACCGAAAACGCCACCGTCGCCTGTCACCCCACCACCGACCCCTG
TTACTCCTTCGCCTACACCGAAAACCCCGCCATCTCCATCACCGCCTGCAACACCGCCGACTCCTATCACTCCTTCGCCTACACCACCATCTCCTATCAC
TCCACCACCGACTCCGGTTACTCCACCATCACCGCCGATGGGCAAATGCCCAGTTGACACACTGAAGTTGCTAGGGTGTGTGGACGCACTCAATGGACTG
GTGCACACGGTGATCGGCAGCAGTGCCAGCGACACATGTTGCCCACTCTTGTCCGGTGTGGCCGGCCTCGACGCCGCGCTCTGCCTCTGCACCACCATCG
AGCTCAAGGCGCTCAACATCAACCTCGTGCTGCCAATTGCCATCCAAGTGCTCGTGAACCAATGCGGCAAGACAGTGCCCAGCGACTTCCAATGCCCTGC
GACTCCACCATCGCCGACACCGGTGATGCCGCCATCCCCACCAGTAATGCCGCCCACCCCTGTTACACCGGTTACTCCGCCATCGCCGACACCAATTACA
CCACCTATTACACCGGGTTACTCCGCCATCGCCGACA
page-top