Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1l11
Contig Information
Length 558 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1l11   
Homology (BLAST) Top Hit dehydrin 5 [Hordeum vulgare subsp. spontaneum]
Score 191
Evalue 3.19917e-13
Total Hit Count 111
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1l11
ATCAATTTATATGCGGTGGAGTATTATTCTGCAAAGGTAGCGGCCGTAGGCAGACCGGGCTTAGTTCAGTCCAGGCAGCTTCTCCATGATCTTGTCCATG
AGGCTCTTCTTCTCACCGGCCCCGTCGGTGCCGTGTGTCCCAGTACCAGTTGTTACGTTGTGTCCTTGCTGCCCACCGTCGGTGGCCGTGGTGCCATGCA
TCTCCGTGCCGGTCATTCCAGTGTGTCCATCCTGCCCGTAGGTGCCAGCAGTATGCTGGTGGTCATCGTGGCCAACGGGGAGCTTCTCCTTGATGTTCTC
CATGGCATCCTTCTTCTTGTCGATGCCGTCGGTGCCCTGTGTTCCCTTATCGGTCACTCCGGTGTGTCCGTGCTGCCCGTAGGTGCCGCCGGTGGACGGG
GTGCCATGCGTCGCTGTGTCGGTGTGTCCTTGCTGCCCGTANGTGTCACCGGTCTGCTGGNGGTCATTCTGGCCCCCGGGGAGCTTCTGATTGGNGTTCT
CCATGATGCTCTTCTTCTCNCCTGTGNCNCCANAAACCNNACNNCTTTGTGNNNGNNA
page-top