Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10i24
Contig Information
Length 318 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10i24   
Homology (BLAST) Top Hit hypothetical protein [Leishmania infantum] >gi|134070937|emb|CAM69613.1| hypothetical protein, conserved [Leishmania infantum]
Score 83
Evalue 0.722876
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>whec10i24
CGACACCCCGTCGAACCCTAACCCGCACCCTGATCCGCCGCCGCCACCGCCTCCACCACCAGCCCACCGAAGCCTCCCACCGTTCCATTCGCTTCCCTCC
CACCGCTTCCTCCTCCTCATAAAGCCTGCCCCGTTCGAAAATCTTTGCCTCCAGATCGTGATCCTGCGGCAGTTCTTGGATCGCCAGATCGATCGGATGG
CTGCCGCGGCGGTGGACCCGATGGTGCTTGGGCTGGGAACGAGCGGAGGTGCGAGCGGGAGCGGAGTGGTAGGAGGCGGTGTTGGGAGAGCAGGAGGAGG
GGGTGCGGTGATGGAANG
page-top