Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10i17
Contig Information
Length 662 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10i17   
Homology (BLAST) Top Hit hypothetical protein OsI_09533 [Oryza sativa Indica Group]
Score 1008
Evalue 8.82724e-108
Total Hit Count 242
Registered year 2003
Contig Sequence     [ Download ]
>whec10i17
CGGGGTCCGACTCGGACGACGACGAGCAGGAGACCCAGCAGAAGAAGAAGGAAGGGGGCATCTCCAACAAGAAGAAAAAGCTGGAACAAAGGATGAAGAT
TGCGGAGCTGAAGCAGATATGCAACAGGCCCGACGTTGTCGAAGTTTGGGATGCGACTGCGTCAGATCCGAAGTTACTTGTCTATCTGAAGTCTTACAGG
AACACAGTACCTGTCCCAAGGCACTGGTCCCAAAAGAGGAAATTCTTGCAGGGCAAGAGAGGTATCGAAAAACAACCTTTCCAACTTCCTGACTTCATTG
CTGCAACTGGAATAGAAAAAATAAGACAGGCATATATCGAGAAAGAGGATAGCAAAAAGTTGAAGCAGAAGCAGCGGGAGCGTATGCAGCCAAAAATGGG
CAAGATGGATATAGATTATCAGGTTTTACACGACGCCTTCTTCAAATATCAAACAAAACCAAAATTGACTAGTCATGGTGACCTTTACTACGAAGGGAAA
GAGTTTGAGGTCAAACTTAGGGAAATGAAGCCAGGTATGCTGTCCCGAGAACTTAAAGAAGCTCTTGGTATGCCAGAAGGTGCACCGCCTCCATGGCTTA
TAAACATGCAGAGATATGGTCCTCCGCCCTCTTATCCTTCACTGAAGATTCCTGGTCTGAAT
page-top