Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10i08
Contig Information
Length 725 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10i08   
Homology (BLAST) Top Hit hypothetical protein OsJ_013941 [Oryza sativa (japonica cultivar-group)]
Score 221
Evalue 1.9445e-16
Total Hit Count 263
Registered year 2003
Contig Sequence     [ Download ]
>whec10i08
ACCGATACTCAACTTGCACAATCTGTATATCACCAGATATCTTAACGACGACGACGACTAGCGTAACAAGAATAACGTCAGCATAGTAAATTCATAACCA
ATATAGCAGGCATCAGCTAGAAGTATACTGTATGCAGGGGGAACATCATCGCGATAAATCATAAGGTAGGTAGCCAGGTAATTTTCCATTACTCAAAATT
TTGATCTAAGCATCTATCTTTCTCTCCCTCTCTCTCTCAATAGCTGCCTCGATCATCAGCGACTTCAGGGACTCGACTCGCTCCTGGCAACAAACCAGCT
GGGTCTTGACGACGAAGCCTCGTCTCCACCATCCAGAAAGTCAGCAGCAAGCGAGCCCCGGGGTCTTCAAAAGGCAATCGACCAATCTTCTTCTTGTGTG
GCCTCAGTGGTGATCTGTTTCTACTCCGCCTTCTTGGTCCGGAAGTTCGACCTCATTGACGCAATCTTTTTCTTGCACTGCACCACTGTTTTACCAGGGA
CAGCAGCAGCTACTCGCTCCCATCTTTGGTTTGCATCCTTGGGAAACGCCTTCAAAGCTTGAACAACGGCCAGCACCTGGGCCTCTGACCAGGCATCTGG
ATCTGTTGCAGAAGGAGCTTCTTCCCTCGTGCCGAATTCGGCACGAGGGTTACTTTCTTGGTTGCAAAGTTTGATGGTATTCTTGGGCTTGGGTTTAAGG
AAATATCTGTTGGCAAAGCAGTACC
page-top