Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3l06
Contig Information
Length 752 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3l06   
Homology (BLAST) Top Hit Os12g0236500 [Oryza sativa (japonica cultivar-group)] >gi|77554110|gb|ABA96906.1| Aspartyl aminopeptidase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648970|dbj|BAF29482.1| Os12g0236500 [Oryza sativa (japonica cultivar-group)] >gi|125536203|gb|EAY82691.1| hypothetical protein OsI_37907 [Oryza sativa Indica Group] >gi|125578926|gb|EAZ20072.1| hypothetical protein OsJ_034281 [Oryza sativa (japonica cultivar-group)]
Score 1054
Evalue 5.31357e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3l06
GTTGTGATTGTAGAAGTACAGGTTCTGCTGACCCAATTATATGGTCGTCTACTACACCTCAGCAGTCTACTTTGACTTTGTTATCCAATTCAGTGAATTC
TTCAAAATATGCCTTGAGATGTTCATATGAGTAGTTGACGTCGTCAACGGCGCACATCTCCCTGATGCTGTGCATGGACAATTGTGGCGCTCCGATATCC
ACAGTACGAATACCAACACCGCTAGCCAGTATTGGCCCGATTGTTGACCCACAAGCCATGTCGTTGCGAACAACAAAATCCTGGATAGGTAACTGGTGCC
TCTCAGCAATTTCTCGGAAAATAAAAGCTGTCACGGCATTTGTAGCATATCGTTGATTAGCATTGTGCTTAATCACAAGTCCACCATGCAACTTTGGCTG
GTGGTTCTCCTCGTGCTTTTCCATATAATTGGGGTGCAAGGCATGAGCCATATCTGCAGACACAAGGAAACTCCTTTGAATAGCCTTTTCTAGCAACTTG
GAATTTGAATGGTTAAAGCAGCCTGTGATTCTTGTTAAAGCATCCAGCATTGCAGGCGAACCAGCTCCCTGAGCTGAATCAGAACCAACCTCCTCATGAT
CAAATAGAGCCACCATCCTGACGCCAGATTCATGATCAAGAGAGTGGTCAGTAGAAGTTGACTCCACTAGGGCCTTCAGTGAACAAAATGACATGCAAAG
GTTGTCAAGCCTTCCCGAAAAGATGAATTCTTTCATGGCAACCTGCTACAAC
page-top