Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10h22
Contig Information
Length 562 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10h22   
Homology (BLAST) Top Hit beta tubulin 2 [Hordeum vulgare subsp. vulgare]
Score 867
Evalue 1.33554e-91
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whec10h22
CCGGAACCCTACCCCTCCCCCGCCGCCGCCATGAGGGAAATCCTCCACATCCAGGGCGGCCAGTGCGGCAACCAGATCGGGGCCAAGTTCTGGGAGGTGA
TCTGCGACGAGCACGGCATCGACCAGACCGGCAAGTACGCCGGCGACTCCGACCTCCAGCTCGAGCGCATCAACGTCTACTACAACGAGGCCAGCGGCGG
CCGCTTCGTGCCCCGCGCTGTCCTCATGGACCTCGAGCCGGGGACCATGGACTCCCTCCGATCCGGCCCCTACGGCCAGATCTTCCGCCCCGACAACTTC
GTCTTCGGCCAGTCCGGCGCTGGCAACAACTGGGCCAAGGGTCACTACACCGAGGGCGCCGAGCTCATCGACTCCGTCCTCGACGTCGTCCGCAAGGAGG
CCGAGAACTGCGACTGCCTGCAAGGATTTCAAGTCTGCCACTCTCTGGGAGGAGGAACTGGTTCTGGTATGGGTACACTGCTCATCTCCAAGATCAGGGA
GGAGTACCCAGATAGGATGATGTTGACATTCTCAGTCTTCCCATCACCGAAGGTGTCTGACA
page-top