Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12o05
Contig Information
Length 677 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12o05   
Homology (BLAST) Top Hit putative CENP-E like kinetochore protein [Hordeum vulgare subsp. vulgare]
Score 636
Evalue 1.27401e-64
Total Hit Count 92
Registered year 2003
Contig Sequence     [ Download ]
>whec12o05
CCTCGGCGCTGCGTCTCGGGGGGCGTGTCGAGGTGGTCGGATCTATCTCCGGTGAACCTTGGTCTGCATAACAGAAAGGATTTTCTTATATTCTGGTGAA
GATGAAAGGAACTCAAGGGTCACAGTTAAGGAAATCCCGTTCATGGTGGTGGGATAGCCACATTAGTCCAGAAAACTCCAAATGGCTCTCAGAGAACTTA
CAAGAGATGGAGATGCAAGTGAAAGAGATGCTGGGACTTGTTGAGGAGGAAGGTGAATGCTCTGCAGAAAAGGCTGAGGTGTATTGCCAAGAACGACCTG
TGCTTGTCGCCCACATCAAAAAATTCTATTGCATGTATCGCGCCCTTGCTGAGCGGTACGACAATGTAACTGGAGAACTGCGCAAAAATATCCCATCATC
ACTGCAGCCACATGGCTCTTTTGGTGCCCCTGAATCAGATTCTGAGACACAGTCTCCTCCATCTACAGAGCAAAAGCCAAAAACTCGATCAGATTGCTTT
GATGTGTCCATTGGCTCTGGTGTGAGCTCTGACGTATCCAAGAAGGGGAGTGATGGGTCTTCATCGTCTTCAGAGTCTGAGTCAGAGCTTGATGAAAGCA
AAGAGGAAAATGGCAACAGCATGTTTTATGCCTTGAGCCAAAGAATTATTGAGCTTGAAGTTGAGCTTCATGAAGCA
page-top