Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_CSEC_all.Contig2093
Contig Information
Length 1266 bp
Tissue Callus
Clones 13 Clones [Download: CSV  ,  FASTA ]
whcs13a05    whcs13k23    whcs13m09    whcs19n07    whcs1a17    rwhcs10f20    rwhcs6e17    rwhcs8e14    rwhcs9j18    rwhcs13k23    rwhcs13m09    rwhcs19n07    rwhcs1a17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1644
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_CSEC_all.Contig2093
TTCACAAACCACAACCAAAAAAGAGTACTTGATTAGCAACTCCATTACAGATACTAGAGGTTGATGCGGAAAACAGAAGGTAACTCATGTCCAACTAACA
TGAACCAGGCGTCGTCTGGCGACACCATCCACATTTATTCTTCGCATAGACAAAGCAGGGACACCTCTGACCAGGCGCCACAAACGAAAGCAGAACGCTC
TACTGAGTCTTGGCCATGTGGCGGATCAGGTCGACAACGCGGTTGCTGTAACCCCACTCGTTGTCATACCACGAGACAAGCTTGACGAAGTGGTCGTTCA
GAGCAATTCCAGCCTTGGCATCAAAGATGCTCGACCTGCTGTCACCGACAAAATCAGTGGAGACCAAATCCTCCTCGACGTAACCCATGATCCCCTTGAG
TTTTCCCTCGGATGCAGCCTTGATAGCCTTCTTGATGTCATCATATGATGCAGCCTTCTCGGTTCTAACAGTGAGATCAACAACTGACACATCCACAGTG
GGAACCCGGAAAGACATACCCGTAAGCTTGCCATTCAGCTCAGGAAGAACCTTACCAACAGCCTTGGCAGCACCAGTGCTGCTGGGAATGATGTTAAAGC
TTGCGGCCCTGCCACCTCTCCAGTCCTTGCTCGAGGGACCATCAACGGTCTTCTGTGTGGCAGTGATGGCATGAACAGTGGTCATCAAACCCTCAATAAT
ACCGAAGTTGTCATTAATGATCTTAGCTAGGGGAGCAAGGCAGTTAGTGGTGCAGCTAGCATTTGAGACAATGTTAACGTCTGAGGTGTACTTGTCCTCA
TTGACACCAACCACAAACATAGGGGCATCTTTGCTTGGGGCAGAGATGACCACCTTCTTGGCACCACCCTTCAAGTGAGCAGCGGCCTTGTCCTTGTCAG
TGAAGACACCGGTGGACTCCACAACGTAATCGGCACCAGCCTCACCCCACGGGATCTCCTCAGGGTTCCTGACGCCAAAGACGGTAACTGGCTTCTCGCC
AAAGAGCAGAGTCTTGTCGTCCTTGAGCTTGATGTCGCTGTGCTTCCAGTGGCCGTGAACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTG
ATGAAGGGGTCGTTGACGGCGACGAGCTCGACATCGTCGCTCTGGAGGGCGACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCT
TAATCTTGCCCATGGCGAGGGAGTGGAACTGCCGCCGACGCTAGACGGAGATGGGAGGTTGCTGAG
page-top