Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec13n02
Contig Information
Length 687 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec13n02   
Homology (BLAST) Top Hit protein disulfide isomerase [Triticum turgidum subsp. durum]
Score 768
Evalue 6.49231e-80
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec13n02
TGGATTTGTTACAGTATTTCTCGCAACGGGAAACAGTATCAGGCAAAACCGGGGCCAACACAACCAACAACCAACTCTCGTCCCCCCCTCGCAAAATCTG
GCGTTGGAAGCTGCCTTGCCAAAACATGTTTCCCCCTCCTCTACCTGTCTGCTGCTAGCAAGACTGATGCTCAGAGCTCGTCCTTCAGAGGCTCGGTGGC
AGCCGGTTCAGCTGCCTTCTCGGTCGCCGCCGCTGCCGCCTGCCCGGCAGTCTCCTTGTTCTTCTTGATGTAGTCGACAATCTCGTCGGCCGTCCTGCCG
CCCTCATACGAGACCTTCTTCCCGCTAGGAGTGACGAAGTAGAGGGTGGGGTAACCCTGGACATCAAACTCGCCGGGAACGTCATTCGCGGTAGCGTCTA
TCTTGGCAATCACAACGTCCTCTTCGCTTTGAAGGGTGGCAGCTGCCTCGTCGAGGATGGGTGCTAGCTTCTTGCAGTGTCCGCACCAGGGTGCATAGAA
CTCGATAAGAACATTTTTGCCAGATTTGAAGACCACGTCGTGAATGTTGTCAGCCACAACTACCTTCACAGGCTCATTGTTGGCCTCAGGAATAGGCTCG
GACTTCCTGAATGGTGTCAATTTGCCATCAAAGTAATCCTTCAACCAAGCAACAATTTGGCCAGCCTCAACCTGTTCCTTCAAAAAC
page-top