Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec12n20
Contig Information
Length 742 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec12n20   
Homology (BLAST) Top Hit cytochrome P450 [Triticum aestivum] >gi|19909886|dbj|BAB87817.1| P450 [Triticum aestivum] >gi|164455202|dbj|BAF97103.1| P450 [Triticum aestivum]
Score 934
Evalue 4.31319e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whec12n20
AGGGAGTCCACACCCAAGGGCGAAAAGCTGGACCTGATAATGGAGGAGGACCTCAGCCGCATGCCGTACCTCAAGGCGACCATCAAGGAGGCAATGCGCA
TACACCCGCCGGCACCCTTCCTGCTCCCACACTTCTCCACCAACGACTGCGAGGTCAACGGATACACCATTCCCGCGGGGACACGTGTCATTGTGAATGC
TTGGGCTCTTGCCAGAGACCCGTCGCACTGGGAGAGAGCGGAGGAGTTCTACCCGGAGAGGTTTCTCCAAGAAGGCCGTGATGCAGAGGTCGACATGTAT
GGTAAAGATATCCGCTTTGTGCCTTTTGGTGCCGGGCGGAGGATCTGCGCGGGAGCTACTTTCGCGATCGCTACTGTTGAGGTAATGCTGGCAAACCTCA
TATACCATTTCGACTGGGAGCTTCCGAGTGAGATGGAGGCCATTGGCGCAAAGGTTGATATGACGGACCAGTTTGGGATGACGCTTCGCCGAACGGAGAG
GCTTCACCTTGTTCCCAAAATTTACAAATAAGTATCAACATCGTAGCTTTGTGTTATTTGTATCGGCTGATAGGTCAGCTAGCCATTGCCCGTTATGTTA
NCTGCCTATTACTATCCCACCTTAATGTANTCGTGTTGCATGCTTTGGGAGTTTGTTGCACATGANAGGAACCTGTGGGATCCTCTACAAATGTAACANC
GAATAATGAANAAAANTATGGTTGTATGGTAAATCAAAAAAA
page-top