Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1m02
Contig Information
Length 758 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1m02   
Homology (BLAST) Top Hit hypothetical protein OsJ_017149 [Oryza sativa (japonica cultivar-group)]
Score 555
Evalue 3.93588e-55
Total Hit Count 185
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1m02
GATCGTTCCACCAGCTTTAAGTGAGCATCTCAAGAAAATATCCACAACCGTCCCAACTGTACCATTTTTACAGTGACATGAGTTATGGTAAACAAACCAA
CTGGGTGAAGCAAGCCTCAACAGGAAAACACGACACATGATCATAGTGCCAAACTCGCCACAGCACCAGCCTTTTGTCACCTTCCCTTCCTTATGTTAAG
ACAAGTAGATACAGCAGGCACCTAAAATATCATCTTTACCATGAAATTCAAAAATCAAACTCTCCTGAAGCCTTGTTGAATAGAACATCTCTGCCATTCA
AATGCATGATTCCATCCTTCAAAGTGCACTTCCAGCGATTCTTTGTCCTTGTTACTTTGTCGAATTGTGCCAGGACAAGGTGCTGCGTGTTAGGTTCCTC
ATCGCCATCCTGTAAGTCATCTATCTCGTCATCGTCATCATCATCTTCATTAAGAGGAGGTTCATCATCATCATCATCATCACCACCCGCCGTATCGTTT
CTTGGCTTTGGTGTTGCAACAGCAGGTGTGGGAGTTCGATATTCCGAAGACTCCCCAGGGGTATTGTAGTCTTCGGTTGGAACTCCTGGGAAGAAAAACT
GATCGTTATAATCATCTTGTATCCCGTCCCGTTGAGGAAGAACTGGTGGTATTGTGCTTTCTTCGATAGAAAGTGTCTTTGTTACTGATTCTTGCTTGTT
CATGATGGAATTCCACACCTGTTGTGCGTTATCCTTTGACCCCACAAATTCGGCAACC
page-top