Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10h01
Contig Information
Length 726 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10h01   
Homology (BLAST) Top Hit hypothetical protein OsJ_031153 [Oryza sativa (japonica cultivar-group)]
Score 985
Evalue 5.03357e-105
Total Hit Count 213
Registered year 2003
Contig Sequence     [ Download ]
>whec10h01
AGTTGCAACATATTGGGCCTGCTGAAGGGAGATGAATTCACTGAGCGTTTCTTCCGAATTCTCACGGAACTTGCTGTTGCACACTCTCTAGTCTCTGAGC
AAATTAATGCTCCTGGTGGATTGTCTCAGCAGTCATCACATATATCATATTTCCCCATTGATTCATATTCGAAGCTTGTGTCTGTGGTGATAAAGAATTG
TTCAGTGGAAATAGGACCAAATAAAGGCAGCCTTCTTCCCAAGATATTGTCAGTGACAATTAGGGTCATTCAGAAAGATGCTGAAGAGAAGAAAGCTTCA
TTTAACCCCCGACCATACTTTCGGCTGTTTATCAATTGGCTGAATGACCTTAGTACTTCTGAACTCCATCATGATGGAGCTAATTTCCAGGTTTTGGCTG
CATTTGCAAATGCATTCCATGTACTGCAACCCTCGAGAATTCCTAGCATGAGCTTTGCTTGGCTTGAGTTGGTGAGTCATAGAACCTTCATGGCAAGACT
GCTGACGGGCAATTCACAAAAAGGGTGGCCTTTTTTCCAACGGCTACTTATTGATCTGTTCAAATTCATGGAACCGTATTTGAGAACTGCCGACCTTTTA
GAACCAGTGCACCTTATGTACAAAGGAACTATGAGAGTGCTGCTTGTACTACTCCATGACTTTCCTGAATTTCTATGTGATTATCACTTCAGTTTTTGTG
ACGTGATCCCTTCCAGTTGCATTCAA
page-top