Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10g24
Contig Information
Length 690 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10g24   
Homology (BLAST) Top Hit hypothetical protein OsJ_023788 [Oryza sativa (japonica cultivar-group)]
Score 1002
Evalue 4.81901e-107
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>whec10g24
AGGCGTTTCAAGATGCAATGGACATGGTAAGACGCCATCGAATAGATTTCAATATGTTGGTTGATTATTGTGGATGGAAAGCTTTTATCAAGTCAGCAGC
AGATTTTGTTAAAGAAGTCAATAACCTTAGCCACATCACTGAATTTGTTTGCTCAATTAAGAATGAGAATGTCAGCTGCAAATTGTATGAGGCGTACATA
TCATTCCCTGAGCAGTGCTCGAGCTCAATGGATAGTGAAAATCTGCATGGCGTCTTGTCAGAGAACAAAGTAACATCTGTACTGATGGCAATCAGAAAAG
CCCTTGAGGAACAAATAGAAGAAAGCTCATCAAGAGAACTGTGCATACTGACCACTTTGGCGCGTAGCGAACCTCCATTGTTGGAAGAAGCATTGAATAG
AATTAAAGTCATTCGAGAACTGGAACTTCATGGGGTTGATGATGGCCGACGGAAGCTTTACCCATCTGCTGAAGAGTCTTTGAAGCACTTGCTTTGGTTA
ACAGAACCAGAAGCTGTTTTTAATGCTGCTTTGGGACTGTATGATCTGAATCTTGCTGCTATAGTTGCTTTAAATTCCCAAAAAGATCCAAAGGAGTTCC
TTCCTTTTCTTAAGGGTCTTGAATGCCTACCTCCTGCTATTATGAGGTACACAATAGATTTGAACTTGCAAGATATGAGAGTGCTCTCAG
page-top