Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10g18
Contig Information
Length 710 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10g18   
Homology (BLAST) Top Hit hypothetical protein OsI_20717 [Oryza sativa Indica Group]
Score 349
Evalue 2.66782e-31
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>whec10g18
ACAACAATACTAGGCCCCCTACTCCAGGCAAATTATTCACTATTTCTCAACGTTTTTTTGTAGGAACAAAAGGCCCGATCATATCGCCCCGCCCGAGACG
ATGGCCCAAGCAAATTGTAAAGGGAAAAGGTTGAGTTTGACGGTCTATTTCAGCGTGTCTCTTCATCCGAAGGCTGAAATGGCCTTTTGGTACCATTCAG
CACCTTGGAAGGAGAGCAAAGATCGCCCACCGAAAGTGCTTAGGGTCTCCTGATCTTGACCTTGAGAGTCCATTGTAGCTTGCCTTCTGGGCGTGGTATA
TCCCTCGGTAAGCGAAGTGGCACCTCAAATTCTCCGAGGGATGACAATGGTGACACCAGGTGTAAATTGTCTGGGTAAATGTTGACGTTGAGTTGCCTCG
CCACCTCAGAAACAATTTCATCCTTCGTTACAGGAGAGCGCAACTCGATCCCTTCGGAGATGAACCGTCTGAACACCACAAAGCCCAGCTTCAAGCCCGC
GTGCTGCTGCCGCTGCGCTGCGCCCAGGAGAAACTGCCAAAGCGGGAGCTCACCACTAACAGTCTAACAGCAGTAACAACCAACAAAAACCAAGCAGCCA
ACCATGTCATACGGCCAACAATTCAAGATCCGCGAGGTGCCCCCGATCGTGCAGGAGCTGGTGGCCGGCGGCGTGCAGGAGCCACCGCGCCAGTACGTGG
TTCCTGAGCA
page-top