Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1m07
Contig Information
Length 707 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1m07   
Homology (BLAST) Top Hit Os08g0525000 [Oryza sativa (japonica cultivar-group)] >gi|29647488|dbj|BAC75417.1| putative GTP-binding protein(RAB11G) [Oryza sativa Japonica Group] >gi|113624259|dbj|BAF24204.1| Os08g0525000 [Oryza sativa (japonica cultivar-group)] >gi|215737031|dbj|BAG95960.1| unnamed protein product [Oryza sativa Japonica Group]
Score 726
Evalue 5.08572e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1m07
GGCTTTTTCAGTTAACAGCGAGAAACAGTTCGTCCCCATTCTTACAACAACTATCCTCCTCCCACCCTGTGAAGTCTGTAACTCAGGTGTGTAACAGAAC
CACAATCCAATTTCGGGCTACATGTTTACAAACGATACCACCAATGACAACAAAAAATTCATCACACCAGGACTGGCTAGCAGCACCCTAACCGGCTCGT
CTGCTTCTGGCCGTCTTTCGAGTCACCGTCGTCGATGCTCACCCTGTTGAGGGATAGCTCGGCCTTGTATGAGTCGGAGTTCAGGATCTTCCTGCTCACG
CTGCTGTAGATCTCCTTGATGACGAGCTCGAATGCTGTGTTGACGTTCGTCGAGTCCAGAGCTGAGGTCTCCATGAAGAAGAGTCCCTCAGACTCGGCAA
GTGCTTTGCCTTCCTCCACTGGCACTTCACGGATGTTGTCCAGATCGCATTTGTTGCCCACCAACATCTTGGCCACCGTGGTGTCAGAATGTGTGTTGAG
CTCCTGGAGCCATCGGCCGACGTTGTCGAATGTGCCCCGGCGGGAGATGTCGTAGACGAGGAGCGCGCCGAAGGCCCCGCGGTAGTANGCGGAGGTGACG
GCGCGGAANCGCTCCTGGNCGGNGGNGTCCCANATCTGGGCCTTGACCTCCTTGCCGNNNATGNNNNTGNTNTGCNNNNGGAANTCNANCCNNANGGNGN
NNNNNNA
page-top