Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3m16
Contig Information
Length 699 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3m16   
Homology (BLAST) Top Hit hypothetical protein OsI_21341 [Oryza sativa Indica Group] >gi|125595795|gb|EAZ35575.1| hypothetical protein OsJ_019058 [Oryza sativa (japonica cultivar-group)]
Score 494
Evalue 8.84912e-52
Total Hit Count 20
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3m16
TATCAGCCGCAAAAGTGTTTTCCCCTGTTGAGAAGGGGAGAATTTTCAGAACAAACCGGTACATCAGTAGGTTGTAGTTGCCCACGACAACAATCACTTC
CCAGCAGAGTAAAACATGCTGGGGTACACCCAGAGGTTCTGTGGGTAACGAAACATATTTCTTGCGAACACAAGGTCCCGACTGGCGGATGGATCCTTCA
TAAGATCCGGCTCATTGCCCAACCATCGTACACCCCAAGGTTGAGAGTGGTGAGTGTAGTACAAGCAGTTGCTTCTCCCTCCCCACCGTTCTGGGTTAAC
ACAGGAAAATGGTGGGGTCCTAATGTCAGCTGCAACGAAGAGTGCCCAATTGTCCAGCTTCTTCATCTCTACCCATTTTGCTGGATTGGTAGACATGTCA
AGGCGGTGGAGTGTACAGAAGCCTGAACTATAGAATGAGCTTAATAGAGAATAGCAAACCATCAGAAGCATATCGCTACAGACCACAAGAAATGGTTTCG
AATGCATGCTTGGGATCTTGCCGCCGCACCACTCTATTGGTAGTTCTTGCAGGCCAAGCTGGGGTGCCAACTGCAAAATGTAGATCTTCATATGATCATC
CATGGCAATGAACTGACCATTTAATTCCACAATCTGCTGTACTTGCACATTGGNAAAGCTTGAGTTCAGACCAANAGTCACTTCCAACTGGCCAGTCAA
page-top