Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10g08
Contig Information
Length 735 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10g08   
Homology (BLAST) Top Hit Os06g0164100 [Oryza sativa (japonica cultivar-group)] >gi|55296130|dbj|BAD67848.1| putative serine/threonine protein phosphatase PP1 [Oryza sativa Japonica Group] >gi|113594941|dbj|BAF18815.1| Os06g0164100 [Oryza sativa (japonica cultivar-group)] >gi|215693878|dbj|BAG89077.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215717113|dbj|BAG95476.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197652|gb|EEC80079.1| hypothetical protein OsI_21802 [Oryza sativa Indica Group]
Score 1179
Evalue 1.65148e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whec10g08
ATTGAAACGATATGCCTTCTCCTTGCTTACAAGATTAAGTACCCGGAGAACTTCTTTCTCCTTAGGGGAAACCATGAATGTGCCTCTATCAACAGAATCT
ATGGATTCTTTGATGAATGCAAGAGGAGGTTCAATGTTCGTCTCTGGAAGGTTTTTACTGACTGTTTTAACTGCCTTCCTGTGGCTGCACTTATTGATGA
CAAGATCCTGTGCATGCATGGGGGTTTATCACCTGATTTAAAGAACATGGACCAGATACGTAACATTGCCCGTCCTGTGGATATTCCGGACCATGGTCTC
CTCTGTGATCTGCTATGGTCAGACCCTGATAAAGATGTTGATGGCTGGGGTGAGAATGACAGGGGCGTGTCATACACTTTCGGAGCTGATAAGGTTGCAG
AGTTCCTTGAGAAACATGATCTAGATTTGGTCTGCAGGGCTCACCAGGTGGTGGAGGATGGATATGAATTCTTTGCAAAGCGTCAGCTCGTAACCATATT
CTCTGCACCCAACTATTGTGGCGAGTTTGACAATGCTGGTGCCATGATGAGCATAGATGATTCACTAACATGCTCATTCCAGATCCTTAAGCCTTCTGAT
AANAAAGGGAAAGCTGGAACCGGCAACTCAAAACCTGGAACACCGCCTAGGAAGATAAAGATTAATATTATTTAGGCAGACCCTTCAGGTATGAAATGAG
TTATTGTGATGGAGCACACCCCCAAAACTTGTTAT
page-top