Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whec10g01
Contig Information
Length 722 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
whec10g01   
Homology (BLAST) Top Hit hypothetical protein OsI_01113 [Oryza sativa Indica Group]
Score 711
Evalue 2.92479e-73
Total Hit Count 49
Registered year 2003
Contig Sequence     [ Download ]
>whec10g01
TTTGGGAGGGCGGCAACGCAGACCCATCTCCCCCAAATCCATCCCGCGGGAGACACGAGCGTGCGAGGGAGAGAGGCCGCTGCTCGCCCTGGTCCCGGTG
GGATGAAGATTGACGATCCCCTCGACTTCGAGGGGGATAACGACCCCCTCCTCACCGTCCGCCGCCCCGCCAAGAGGAAGAAGGTTATTGAGCTGGATGA
TCTCGTAGAAGATTACTTTAATTCCGGTAAGGATGAGCTCAAAGCTTCTGCTGCTAAGTCTAAGGGTCGCCCCAAAGGAGACAATTCAGATGATGAAGAC
AAGCAGGTCAGGAAGGAGATTGACTTCTGCAAATTTGTGGAGGAGTGTGAGGAGAAGGCGAAAGCGATGGATCCTGGAGAGGATGTACCCCAATGGGGCC
AGCAAGTTTTCGGCTGTCAGAAATCACCCTCAGGTCTTAATGGCACGGGAGTTGAAAATTGCCAACTTTTGCAATCATTCTGTGGAGATAAGCAGTTAGG
TTTTGATCTANAAATTGAACGAGGAGAGGGCTTTTTANAAGGCATGCTGATCAATGGATGGCTTTTGAAGTTGGTACTCCTATATGGTTCTGTTGAAGAC
TCTATAGCATCATGGGTGCTAACCAAGTTGCTGTACTCATCCAATAANAANTTGCAAGATTCTGCATCTGAATTTTGGGATANTCTCCTTTCCCTAAATG
ANGATGATAAACCATTGGTAAA
page-top