Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec13o12
Contig Information
Length 739 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec13o12   
Homology (BLAST) Top Hit PREDICTED: hypothetical protein [Macaca mulatta]
Score 85
Evalue 1.19733
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>rwhec13o12
ATAAGGACTCAACCCATTATAAATATATACAACAAAAATACAAAATGCATCCGTGACCAAAGTCCATCCATATCCAAGCCCAGTCTGCCCTTCTTTCGTT
CAGCTGGCAACAAACACTTCACCATTTTTGCTAAAGCCTTAGCAAAAATGTAATCAAGCCTTAATCTTCATTTGCTATGCAAAATAACCANGCAGAGCAG
ACACCNGACTANCAATANAACTGAAACNTAAATGGGGATGTCAACAAGGCTCAGACATCCNAGGAAGGAATTAGCAGCACTAGCTCTCGAGCCTGGCTGG
GCGAAAGCTCTTANGCGGCAACTGCGAATGTTTTGAGAAACAAGCCTTAAATTTGTCNTCNCTGCCATACCATTTCCCCAGNTANTCAGATCATATTGCA
CGATAAACAGATCTGTANATCAGCAAACACAATCTCNGGNACATATATAAACATGTGTTGAAAGAGACAAGGCAACAAGCAAATTTATACATAGAGAATT
AGACATTGCAAAAAAAAACAGAGCAANGCACACAGCTGAATGAAACCAGGTGCAAACAGAGATTCCAGCCAAACGACGACAGTAAACACTTCAGTGATTA
TTAGTGGATGTTGTATCAACATAAGAAGCAATATTTAACCTCAGAAAGCCGCAAAAANTATCGTCATTCTGTATCTGACGGTAATTCCAACATAGCTAAT
CATCATAGGCATCAATTGCATTCTAGCTGTATAAAAACA
page-top