Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3n03
Contig Information
Length 699 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3n03   
Homology (BLAST) Top Hit retrotransposon protein, putative, unclassified, expressed [Oryza sativa (japonica cultivar-group)]
Score 221
Evalue 1.78541e-16
Total Hit Count 192
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3n03
CTCCGCTAGTCATTTCCGCACAGATACAGGATTTGGTACAGAATCGATCGAGAGCTAGGGTTCCTGAGAGGGAAGGAAGGAAATCGGGAAGGTAGCCGCC
GCCAGATACAACTAGTTAATCGCCACCTCACGCAGGAGGGCTCGGTCTCCCTTTAACCCTGCCCGTGGTATCCCACACTTGGGCCAGGAAGCGACTGTTG
GGCTTGGGCTGTCGGCGAGGTCGTTCCAGCCCAACAGGAGCTGTCTTGGTTGCAGTCGGTGGGGTCGCCATGTCAGGGGCCGTGACATCCCCCCCTCCAT
GAGACACAGCTTGTCCCCAAGCTGGCGCCCTCGGAAAGTGTTGCAGCAGCTCCATGCGATCTTCCCAAGTTGCAAGTTCAGATGGTTGATCTGTCCACCG
TACCAGGACCTGTGGTACCTGAGTGCCGCCCCGCTGGACTTGACGGTCCTGTAGGATCTCTTCCGGCACCGGACTTGAAGCCGCTGCTGCTGGCAGTTGA
ACTTGCGCCTGCTCCGTGGGCGGTANCGCTTGACGGANCTGGGANACNTGGAANACTGGATGCATGGTGCTGGACTCCNGTANGCNAAACTTGTATGCNA
CNGCACCAATGCNCTGNACAACCTGNTACNGNNCNAANTANCNAAATGCCNACTTTTNATTANNANNNNTGNNCACCNNACNCTNNNNNNANGNNTNNA
page-top