Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec1m13
Contig Information
Length 123 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec1m13   
Homology (BLAST) Top Hit regulatory particle mon-ATPase subunit 3 [Triticum aestivum]
Score 183
Evalue 1.81426e-12
Total Hit Count 175
Registered year 2003
Contig Sequence     [ Download ]
>rwhec1m13
CTAAGCTTCTTCGCAATATCAGCAAGGGAGATCCGCGAGTATGAAATGCTGATGTTGCGTAGTCCAGTTCNAATGACATTGTGGCGGAGCCTCACAATCA
AATTGTGAGTCCTGTCTGCCCTC
page-top