Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3n17
Contig Information
Length 700 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3n17   
Homology (BLAST) Top Hit Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|32488409|emb|CAE02834.1| OSJNBa0043A12.39 [Oryza sativa (japonica cultivar-group)] >gi|90265248|emb|CAH67701.1| H0624F09.9 [Oryza sativa (indica cultivar-group)] >gi|113565789|dbj|BAF16132.1| Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|125550177|gb|EAY95999.1| hypothetical protein OsI_17870 [Oryza sativa Indica Group] >gi|125592017|gb|EAZ32367.1| hypothetical protein OsJ_015850 [Oryza sativa (japonica cultivar-group)]
Score 534
Evalue 9.1536e-53
Total Hit Count 355
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3n17
ACAAATTGTTAACGCTATAAATCCAGTGCCCAGAGTGCACAGCAGCACAGGCATCGATCAAATGTTTCTTGATCCCAAGCATTCCGAGAAAATTAGAAAT
GTAAAGAAGAAAACTGAATTTCAAATCTTGCGTTCTGCCGACTCGGACTGATCGACTGCACACTGATCGGCTTCTGTCAATCATCAAATCAATCGGGCAT
GGCAGAACGCGGCTGTAACGAAGAATCATCGTCATCCCTAGGTGCGGCAAATCTGGAGAGGGGCGACGACGTCCGCCATCTCCTCGCACGCCGCGGCGCC
GACCTGGATGAGGTCAGGCACGCCCTTGCTCATCAGCAGCCTCCTCCGGCATTCCTCTGCGGCGTCCATGCCTGACGAGTACGCGCCGTGCACAGCCCCC
GAGTGCTCCGCGCTGGCCGCCTCTCCGGCGAAGTACAGCACGCTCTCCACCGGCGCCGAGAACCTCTCGCACACGTCCGACGGCTTGCCCACCAGGTCGC
ACGAGTAGGACCCCAAAGAGTTCGGGTCCGAGCCCCACCGTGACACCAGGTACTGAGTGGGTTCAGTGGCGTCGGGTATCATCTTCCTCANGTGACACAT
GACGAGTTCCACCGCCTCCTTGTCTGANAGCTTCTCCACATCCTGGGCGAACCGACCGGCGGNCATGAANACCANCACCGGGTGGCCGGTGGCCTTGTGG
page-top