Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3n20
Contig Information
Length 710 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3n20   
Homology (BLAST) Top Hit unknown [Zea mays]
Score 311
Evalue 6.8e-27
Total Hit Count 21
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3n20
ACTCGCACGACCGCACAAAAAGCTACACATGTCAAGTCATCTTCACCACCACCACCAATCCGCTTCCTTCCTTCCTTCCTTCCAAGGTACACTTACTATA
GTACTAGTAGTAGGATACATCTCAAGGAACAAGAGAACCACGATTACACGCTATGGCAAACACAAATTATGATCCAAGATCGATCGATGCTACTAAGGGC
CCAAAAGAATACAATACAGTGCTTCCTTTTCTCCTCTCCGGTGCAGCAAGTCCCTTCCTTCCTTCCTTCCTTCCTGCCCAGTCGTTATCATACATACCTT
CGACACCGCTTCGTCGTCTTGGTGGCAACATGGAAGCTTCTGGGCAGGCGGTGTTAGATCCTCAGATGAATGAAAAACTACTGCAATGCAATGTACGTCT
GACAACTGCTTGTTCCAGCATCGTCTGGTTTCATAGCAACCCAGCTAGCATGGCACCCGGGTCGTTATATGTCGCCGGCGCTGCTGGAGGCAGCTGTGGT
TGTTGCGGAGCGGCAGGGGGGGCCACTCGAGCCCTCGGGATGTCGATCAGATGTTCCTTGATGTACTCCTTCAACTCGAATGTCAGATTTTGATCTCCTG
ATGCGACTGTTAGCCGGAGCTGACTTCTGTCTTGGGGATCTGTTTCAACTCTCACCAGACAAAGCGCGGCATTGGTTGTCTCCGAAAAGAATGTANCACA
CGCCACCATG
page-top