Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhec3o06
Contig Information
Length 670 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhec3o06   
Homology (BLAST) Top Hit hypothetical protein OsJ_022293 [Oryza sativa (japonica cultivar-group)]
Score 558
Evalue 1.38213e-55
Total Hit Count 51
Registered year 2003
Contig Sequence     [ Download ]
>rwhec3o06
AGCACTCATTACTGTGAAAAAACCCACAATTGTATACAACAGAAACTAACAACAAGAGCACGGGCGCAATGAAAACTCTAAATCTTTCACCCGCTCACGC
CCTCACGGTCAGCCGCACATAACAAATGAAGGGATGACGACAGGAGTCGTTTCATTCTGATTGTTTTCTAGGGTATCCTAGAACTCGTCATCAAGAGAGT
AATCCTCGTCATCGGGCAGCATGGCCGTCAGGAGCGAGTACCGCACCCGCAGGGATATCTTACCCCTCTCGAGGTGCAGCTTGGCGCCCGACACCACCCA
ATACCCCGGCAGGTCCTGCGGCCCACGCACCATCTCCGTCGTGTCCACAAACTTGAGAAGCTTTGGGGGCTGCACCGGGGCGGGCGGGCCGCCGGGGTAC
ACCGCCGAGTTGATGTTCACATCGGCAGGGCGGGGCATCGGCTTCTGGACCGCCGTGGAGAAATGCGTGCTGATGAGCGTCGAGATGAGGCCCGACTTCT
GGATCANGTTCGGGGACCCCTCCCACTCANGCTGCCTGACGGANTGGGCGTTCACNACCTTGGANAANTGCAACCGAANGAACANTATCTTCTTGAANCC
CTGGNTGATTACTTCTANCCNNGCTCCTGTGACNATGGANGNNTCCTCTGANTCNNNNNGNNNTGNGNNA
page-top